İlk Yerli Elektrikli Otomobil

Yerli Elektrikli Otomobil 3 Ay Sonra

Yerli Elektrikli Otomobil 3 Ay Sonra

Yerli spor otomobili üreticisi Etox’un sahibi Ercan Malkoç, Türkiye’nin tamamem yerli ilk elektrikli otomobilini 3 ay sonra üretmiş olacaklarını söyledi

Daha önce ürettikleri yerli spor otomobil Etox’un, elektrikli binek türünü hazırladıklarını belirten Malkoç, Elektrikli Etox’un, saatte 120 kilometre hız yapacağını ve bir dolumda 250 kilometre yol gideceğini ifade etti. Elektrikli Etox için şu anda 4 yerli firmanın ayrı ayrı motor geliştirdiğini anlatan Ercan Malkoç, bir yerli firmanın da kendileri için batarya geliştirdiğini bildirdi. Elektrikli Etox’un prototipinin 3 ay sonra hazır hale geleceğini bildiren Malkoç, “Bizim yapacağımız elektrikli otomobil öyle çok küçük olmayacak. Bildiğimiz 4 kapılı, ihtiyaç duyulduğunda devlet dairelerinde de kullanılabilecek yerli bir otomobil olacak” dedi.

Malkoç, AA muhabirine yaptığı açıklamada, 2007 yılında yerli spor otomobil Etox’u yaptıklarını ve çok ciddi ilgi çektiğini söyledi. O dönemde 200’ü aşkın sipariş aldıklarını anlatan Malkoç, şöyle konuştu: “Aracın motor hariç tüm aksamlarını kendimiz ürettik, ama motoru maalesef bir firmadan almak zorundaydık. Firmayla yaptığımız görüşmelerde bize motor vereceklerini söylediler, ama o dönemde arabamızla ilgili haberlerin etkileyici şekilde yer alması ve bu işte bizim iddialı olduğumuzu gördüklerinde bize motor veremeyeceklerini söylediler. Sonra biz başka firmalarla görüşmeye başladık, ama hiç biri bize motor veremeyeceklerini ve motorun yurt dışına bağlı olduğunu, yurt dışındaki merkezlerin de buna izin vermediğini belirttiler.

 

Motorsuzluktan dolayı bu otomobili o günün şartlarında satamadık. Ancak iki tane yapıldı. Bir tanesinin tip onay belgesi alındı, seri üretim belgesi alındı, trafikten plaka çıkarıldı ve şu anda kullanıyoruz. O günden sonra dışa bağımlılıktan kurtulmak adına biz de elektrikli otomobil yapmaya karar verdik.

Sayın Başbakanımızla da görüşme imkanımız oldu. Sayın Başbakanımız da “elektrikli yapın” dedi. Biz de elektrikli için Sanayi Bakanlığının SANTEZ projesine başvurduk, oradan bize bir hibe çıktı. O hibeyle birlikte şu an elektrikli ve 4 kapılı bir otomobil yapmaya devam ediyoruz. 3 ay içerisinde bu otomobili hazır hale getireceğiz.”

“30-35 BİN LİRAYA ELEKTRİKLİ OTOMOBİL SATMAYI HEDEFLİYORUZ”

Tasarladıkları elektrikli otomobilin ilk etapta 120 kilometre hız yapabileceğini ve bir dolumda 250 kilometre gidebileceğini belirten Malkoç, elektrikli Etox’u 30-35 bin liraya satmayı hedeflediklerini ifade etti.

Elektrikli otomobilin çok ekonomik olduğunu vurgulayan Malkoç, “Bir bataryayı 10 dolara dolduruyorsunuz ve 250 kilometre yol gidiyorsunuz. Şu an ki yakıta göre yüzde 90 daha ucuza geliyor. Ülke olarak otomobil yapamamamızın en büyük nedeni motorda dışarıya bağımlı kalmamızdı. Çünkü Türkiye’de bugüne kadar motor yapamadık. Elektrikli otomobil bizim için büyük bir fırsat oldu. Artık batarya da motor da Türkiye’de yapılabilir. Yani dışarıya bağımlılık kalmıyor. Dizel ve benzinli motorda kaçırdığımız treni elektrikli motorla yakalayabiliriz” diye konuştu.

Şu anda 4 yerli firmanın elektrikli Etox için ayrı ayrı motor hazırladığını belirten Malkoç, bir yerli firmanın da batarya geliştirdiğini anlattı. Etox üzerinde yaklaşık 4 yıldır çalıştıklarını dile getiren Malkoç, şöyle konuştu: “Etox’un 3 yıl önce seri üretim belgesini, tip onay belgesini, kapasite belgesini aldım. Fransa’dan pin kodunu aldım ve o günden bugüne de enerjimi hiç kaybetmeden pozitif bir şekilde aracı geliştirmeye devam ediyoruz. Etox, İstanbul Teknik Üniversitesi’nin test merkezinde 33 tane teste tabi tutuldu ve yüzde 88 gibi yüksek bir oranla geçti. Oradaki hocaların bir çoğu aracın Türk yapımı olduğuna inanamadılar.

Bu deneyimler sayesinde artık aracın motor hariç bütün aksamlarını başarılı bir şekilde üretebiliyoruz. Yapmış olduğumuz Etox, gezerken herkesin ilgisini çekiyor. Porsche, Lamborghini görünümünde bir otomobil ortaya çıkardık, ancak bizim burada en büyük eksiğimiz otomobilin motorunu yapmaktı. Artık elektrikli motoru da kendimiz yapacağız. Şimdi 4 yerli firma bize elektrikli motor geliştiriyor. Batarya için de bir firma çalışıyor. Türkiye’nin ilk tamamen yerli yapım elektrikli otomobilini 3 ay sonra bitirmiş olacağız. Yüzde yüz yerli olacak. Sayın Başbakandan da bize destek olmasını istiyoruz. Gerekli destek sağlanırsa 1 yıl içerisinde seri üretime geçebiliriz.”

“ARTIK TEKERLER TÜRKİYE’YE DÖNSÜN”

“Şu an dönen tekerlerin hepsi ya Fransa’ya ya İngiltere’ye ya Japonya’ya ya Almanya’ya ya da ABD’ye dönüyor. Onlar da bir şekilde bu sistemi bozmak istemiyorlar. Artık tekerler Türkiye’ye dönsün istiyoruz” diyen Malkoç, Başbakan Recep Tayyip Erdoğan’ın Türkiye’nin kendi otomobil markası oluşturmasının zamanı geldiği yönündeki düşüncelerinin çok doğru ve yerinde olduğunu kaydetti.

Bunu gerçekleştirmek için kendileri gibi 5-6 firmanın bulunduğunu ifade eden Ercan Malkoç, şunları söyledi: “İşin açıkçası büyük otomotiv firmalarından medet umulmaması gerekiyor.

Hemen hemen hepsi distribütör olduğu için kendi markalarını yaratma gayeleri yok, şansları da yok. Çünkü hepsi göbeğinden, bacağından yurt dışına bağlı. Kimse kendine rakip çıkarmak istemiyor. Zaten bunlar al-satçılar ve yıllardır ciddi oranda paralarını kazanıyorlar. Sistemlerini kurmuşlar, tıkır tıkır çalışıyor. En çok arabayı onlar satıyorlar. Yurt dışından emirler geliyor ve ona göre hareket ediyorlar. Niye kendini sıkıntıya sokarak Türk otomobili yapmaya çalışsın? Dikkat ediyorum, hepsi bugün bunun nasıl yapılacağını değil, niye olmayacağını anlatmaya çalışıyor. Sayın Başbakanın önüne bol sıfırlı rakamlar koyuyorlar. Otomobil üretebilmek için bir tanesi 750 milyon Avro’dan bahsediyor, bir diğeri 1 milyar avro’dan. Halbuki 50-60 milyon avro’luk bir yatırımla yılda 2500-3000 araç üretebiliriz.

Bizde şunu iddia ediyoruz; bu gibi projeler, bir iki kişiye vermektense bizim gibi bu işe gönül vermiş, kendi otomobilini yapmaya çalışan ve geçmişi olan firmalara verilirse Türkiye’nin 5-6 tane otomobil markası birden çıkabilir.”

(Alıntıdır:http://www.elektrikport.com)

Biz neden yapamayalım ki yapanlardan bizim neyimiz eksik! Tabiki eksik hiç bir  yanımız yok. Mühendisse mühendisimiz var, iş gücü ise iş gücümüz var, teknolojiyse oda var. Bizim eksikten çok fazlamız var o fazlalıkta bu tür işlerin yapılamayacağını haykıran fazla gereksiz insanlar var. Yok biz bunu yapamayız yok çok maliyetli olur rakiplerle bu pazardan pay alamayız yok o yok bu. Bu yazıyı okurken direk aklıma DEVRİM ARABALARI filmi geldi. Yıllar önce biz ilk arabamızı yapmışız tüm köstek olmaya çalışanlara rağmen ama böyle bir başarıyı milletimize yakıştıramayan yabancıların yalakalığını yapan insanlar yüzünden malesef hala acaba yapabilir miyiz kısmındayız. Yaparız yeter ki engel olunmasın destek çıkılsın hem de çok iyisini en iyisini yaparız. Umarım bu araç için motor olayını da yerli pazarda yaparız ve dışa bağımlı olmadan tamamen yerli aracımızı yapıp en kısa sürede seri üretime geçeriz. Tek korkum bu tür girişimcilere köstekçiler tarafından zarar verilmesi.(Bu arada yazımda da söylediğim Devrim Arabaları filmini izlemeyen muhakkak izlesin çok önemli ve tamamen gerçekleri yansıtan bir yapıt…)

 

 

Sinan Ergin

 


 

 

Reklamlar
Teknoloji içinde yayınlandı | Yorum bırakın

Dünyada Bir İlk

Güvenlik konusundaki yatırımlarıyla tanınan İsveçli otomobil devi Volvo, dünyanın ilk elektrikli otomobil çarpışma testini gerçekleştirdi.

Elektrikle çalışan Volvo C30 modeli bir araca saatte 64 kilometre hızla çarpışma testi yapıldı. Uygulanan test başarıyla sonuçlandı ve otomobilin hayati önemdeki fonksiyonları zarar görmedi. Hasarlı C30 elektrikli konsept, ABD’nin Detroit kentinde sürmekte olan otomobil fuarında 23 Ocak’a kadar sergilenecek. Ziyaretçiler, aracın yüksek voltaj kablolarının ve elektrik aksamının herhangi bir zarar görmediğine şahit olacak.

Elektrikli otomobillerin motorları, diğer araçların motorlarından daha küçük. Gaz tankı yerine çok büyük bir batarya kullanılıyor. Volvo’nun yayınladığı test görüntülerinde, saatte 64 kilometre hızla duvara çarpan otomobilin T şeklindeki ve 300 kilogram ağırlığındaki bataryasının hiçbir hasar almadığı görülüyor.

Elektrikli Volvo C30, 2012’de önce Avrupa’da daha sonra da ABD’de satışa çıkarılacak.

 

(Alıntı:http://www.zaman.com.tr)

 

Teknoloji içinde yayınlandı | 3 Yorum

Son An-İlk An

Belki konu başlığım biraz da olsun anlatıyordur neden bahsettiğimi. Yazımı muhtemelen havai fişekler patlarken yada patladıktan sonra yayınlayabileceğim. Belki de o an o geçiş anı için böylesi daha güzel olsa gerek. İnsanlar geri sayım yaparken o an da ben yazımı tamamlamaya çabalıyor olacağım. Bir kaç dakikadan  sonra geçen yıl olarak adlandıracağımız şu 2010 yılı güzellikleriyle kötülükleriyle geri kalmış olacak. Geçip gidecek. Ama tıpkı öncesinde olduğu yıllar gibi bu yıl da bitecek bir kaç dakika sonra  yenisine başlayacağımız yılda bitecek. Bir açıdan!(yaşlanıyoruz) hiçte iyi olmayacak bu yılları birer birer tüketmemiz; ama diğer açıdan bitirdiğimiz yılın bize neler kazandırdıkları ile çok daha güzel şeyler olacak gelecek için; yeni yılda daha güzel neler olabilir neler yapabilirim neler başarabilirim nasıl daha çok mutlu olurum çevremdekileri mutlu ederim diye düşündükçe insan  işte o zaman yeni yılı kutlamış olur. Keşke her yeni yılı bu düşünceler eşliğinde kutlayabilsek.

1 yıl önce bu saatlerde İrlandadaydım. 2010 a orada girdim. Ama dönüp arkama baktığımda sanki anı yaşıyor gibiyim.  O kadar çabuk geçmiş ki anlayamadım kendimi bir an orada sandım ama değilim. 2010 un bana kattığı yaşattığı güzel şeyler oldu. İrlanda maceram çok güzeldi. Orda tanıştığım, beraber gittiğimiz bizden sonra gelen  arkadaşlarım dostlarımla sevdiğiM kişilerle güzel bir dönem-yıl geçirdik. Mayısın son gününe kadar Türkiye,aile arkadaş özlemiyle yanıyordum. Haziran ilk haftası itibariyle koşuşturmaca başladı. Daha bismillah yeni ayak bastım ye eğlen gez hasret gider tatil yap. Ama böyle olmadı tabi. Gelir gelmez erasmus dönüş evraklarıyla uğraş. Ay sonuna doğru staja başla, staj bitti az bir akraba ziyareti derken bir baktım okul başlamış. Okula git gel aynı tas aynı hamam belki önemli faydalı şeyler ama öğrenciye düzgün aktarılmadıktan sonra boş şeyler le rapormuş deneymiş sayfalarca not muş baktım olmayacak bir şey öğrenemeden mezun olmaya doğru gidiyoruz. Kendimce karar aldım ve işi yerinde fabrikada öğrenmeye karar verdim ve arayışa düştüm. Ve sonunda 2 haftalık staj döneminden sonra iş teklifiyle işe başladım. Bu arada yurt dışının tadını bir kere aldım ya durulur mu hemen arayışlara başladım yazın nasıl hangi firmaya giderim staj yaparım diye. Açıkçası zorlu bir süreç arayış başvurularımı yaptım şuan bekliyorum. Umarım olur da önümüzdeki yazda yurt dışında çalışıyor mesleki anlamda dilimi geliştiriyor olurum. Artık hayırlısı kısmetse yazgımızda varsa olur inşallah.

Neyse ben fazla uzatmayayım havai fişekler patlamak üzere geri sayım başladı 10-9-8-7-…..3-2-1 VE 0. işte 2011 yılına girdik. Umarım 2011 yılı barış içinde huzurlu bir şekilde geçer.  Herkes için temennim mutlu sağlıklı başarılı hep sevdikleriyle beraber olabileceği bir yıl geçirmeleri. Zorluklara karşı sabırlı inancını kaybetmeden nice yıllar geçirebilmek dileğiyle.  Sevgilerimle Nice Yıllara

Sinan ERGİN

| 1 Yorum

Mühendiscik Adayı

Gece gece uyku bastırmak üzereyken içimden biraz bişeyler karalamak geldi. Belki sıkıntıdan belki yorgunluktan belki mutluluktan belki… bu belkiler uzayıp gidecek sanırım. Her geçen gün daha çok şey öğrenmek, yada daha çok şey öğrenmeye çalışmak beni mutlu ediyor. Açıkçası her geçen gün gelecek mesleğimi daha da çok sever oluyorum. Ne kadar zor bir meslek! Elektrik Elektronik Mühendisliği…. Belki doktorluk kadar olmasada doktorluğu aratmıcak  zorlukta. Zorluğu tabiki sürekli kendini güncellemek tıpkı bir doktor misali. Ama bu meslek gerçekten gönül vermek isteyen bir meslek. Niye şimdi durup dururken bu yazı nerden çıktı diyebilirsiniz. Açıkçası tam olarak bende bilmiyorum ama sanki bunları buraya yazmak belki de rahatlamak için. Ne önemi varki niye yazdığımın. Mühendislik adı gerçekten büyük çok büyük şeyler ifade ediyor.Ne okuyorsun  Mühendislik okuyorum.” Oooo o zaman kafan rahat okul bitsin işin hazır!” gerçekten böyle mi acaba. Yada kendi mesleğim için söylemek gerekirse Elektrik Elektronik Mühendisliği okuyorsan sırtın kolay kolay yere gelmez işsiz kalmazsın. Peki gerçekten bu böylemi. Açıkçası ‘böyle’ demem de sakınca görmüyorum. Belki bu seneye kadar hep tereddütüm hep ne olucak acabam var aklımda her öğrencide olduğu gibi. Okulun bitmesine yaklaşılan  her gün kafalar soru işaretleriyle tedirginliklerle doluyor. Aslında dolmalı da. Benimde tedirginliklerim belkide yerine göre korkularım var. Özellikle de erkek için bu korku tedirginlik çok daha doruk noktalara ulaşıyor. Okul bitene kadar zaten babadan geçinmişiz okul bitmiş 22 -25 yaş aralığına gelmişiz babadan para istemek çok ağır gelir. Belki kızlar için bu konu daha basit ama bir erkek için hiç de öyle değil.Artık erkek ayaklarının üstünde durmak zorunda. O yüzden okulun sonuna yaklaştıkça korku tedirginlik had safhaya eriyor.  Ama ben biraz daha fazla umutlanmaya başladım. O kadar ders kesmekeşinin arasında ödevlerin quizlerin sınavların arasında belkide bir Mühendisin olması gerektiği gibi herşeye vakit ayırabilen en azından ayırmaya çalışan biri olarak artık başım önümde ileriyi daha iyi görmeye çalışıyorum. Korkularımı yenmeye azaltmaya çalışıyorum. İlk iş deyeneyimimi yaşama heyecanı içinde belki bundan sonra bir süre biraz fazla yorulucam belki bazı şeyleri yapmakta zaman ayırmakta zorlanıcam ama hepsine daha iyi daha planlı olarak yetişicem yetişmeye çalışıcam. İnşallah Rabbim de nasip ederse part time olarak mesleki anlamda bir fabrikada  ilk iş deneyimime başlıcam. Benim için inşallah güzel bir tecrübe olacak. Umarım geleceğe emin adımlarla mesleğimi daha çok sever daha umutlu olarak yürüyeceğim.

Not:[Mühendis  her şeye vakit ayırmalı hiç bir şeyi es geçmemeli… UYKU:) , sinema, yürüyüş,gezme tozma, arkadaşlarla vakit geçirme…… ve tabiki MESLEĞİ:)]

Sinan Ergin

Elektrik Elektronik Mühendiscik Adayı:)

| 6 Yorum

Sınır Tanımayan Teknoloji

1 Gramı 900 Terabayt Olan Canlı Sabit Disk

Günümüzün en büyük ihtiyaçlarından olan veri depolama problemi kullanılmakta olan geçici ve kalıcı hafıza birimlerince giderilmeye çalışılmaktadır. Ancak artık durum biraz değişecek. Yeni geliştirilen canlı sabit disk besleniyor, çoğalıyor ve veri depolama kapasitesini arttırabiliyor.

Günümüz insanlarının yanlarından ayırmadıkları şeylerin başında flash diskler, usb bellekler ve son dönemlerde de taşınabilir harddiskler gelmektedir. Bunlardaki ihtiyaç ise giderek artan veri depolama, eski bilgilerin, fotoğrafların ve videoların saklanması isteğinden kaynaklanmaktadır. Her ne kadar bugün terabaytlara kadar çıkılsa da yine yetersiz kalınmaktadır.

Canlı sabit disk… Evet ilk duyulduğunda verilen tepkiler hep aynı. Ama teknolojinin sınırı olmadığının en güzel kanıtlarından birisi. Aslında mikroorganizmalar üzerinde veri saklama fikri yeni bir olay değil. Yıllardır üzerinde çalışılan bir konu. Ama bugüne kadar somut bir proje ortaya çıkmamış derken 2010 yılının sonlarına doğru gelen haber herkesi heyecanlandırdı. Hong Kong’lu bir ekip E. Coli adı verilen bakteriler üzerine bir bilgisayarın tüm hafızasını dolduran veriyi DNA dizilimi şeklinde aktarmayı başardı.

Yaşayan bakterilerden en basit olanları bile çok uzun miktarda baz diziliminden meydana geliyor. Bakteriler canlı ve çoğalma yeteneğine sahip. Dolayısıyla üzerlerine aktarılan verinin kopyalanıp çoğaltılması oldukça kolay oluyor ve kopya sayısının istenilen kadar olması sağlanabiliyor. Ayrıca mikroorganizma canlı olduğu için dayanıklılığı da çok yüksek ve veri kaybolması, bozulması gibi problemlerin yaşanması durumu oldukça azalıyor.

Prensip olarak herkesin lise yıllarında öğrendiği adenin, guanin, sitozin ve timin baz dizilimi kullanılıyor. Oldukça basit olan bu sistemde 4 adet baz kullanıldığı için tüm sistem 4’lük sayı tabanına göre tasarlanmış olup dizilimler ona göre yapılıyor. Dörtlük sistemde her rakamın karşılığı olan bazlar ise 0=A, 1=T, 2=C, 3=G şeklinde belirleniyor. Örneğin dörtlük sistemdeki 1203 ün karşılığı TCAG oluyor. Eğer karakter bazında çalışılacak ise ASCII tablosundan yararlanılarak karakterlerin 7 bitlik ifadeleri 4’lük sisteme oradan da DNA dizilimine dönüştürülebiliyor.

1 gram bakteride maksimum olarak 931,322 Gigabayt yani yaklaşık olarak 900 Terabayt veri saklayabilmek mümkün oluyor. Ama artan depolama ihtiyacına göre kullanılan bakteri sayısı da değişebiliyor. Örneğin uzmanlar gerçekleştirdikleri bir projede, Amerika’nın Bağımsızlık Bildirisini 18 adet E. Coli bakterisine yerleştirebilmişler. Şu an da uzmanlar, canlıya zararı olabilen ve tekrarlanan uzun dizilerden kurtulabilmek için çeşitli algoritmalar üzerinde çalışıyorlar.

 

Şimdi bir örnekle durumu açıklayalım. Örneğin “ELEKTRİKPORT” verisini canlı bakteri üzerine aktarmak istediğimiz zaman karşılaşacağımız durumlar şöyle:

Verinin 4’lük sistemdeki ifadesi

101110301011102311101102103001023110010331102111002000031

Verinin DNA kodunun ifadesi

TATTTAGATATTTACGTTTATTACTAGAATACGTTAATAGGTTACTTTAACAAAAGT

Verinin sıkıştırılmış DNA kodunun ifadesi

TGCAGTCCTGAGGGTTTGATGGTTAAGCAACTGGACGGTAAAGCGGAAAAGGAACCTTATGCAAAATTAAAAATGCCCAAAAA

GGAGC

Görüldüğü gibi alışılagelmiş veri depolama sistemi değişerek, yerini artık canlı, beslenebilen, çoğalabilen ve daha dayanıklı veri depolama sistemlerine bırakacağa benziyor. İlerde kim bilir belki her insan istediği kadar veriyi kendi üzerinde depolayabilir.

(Alıntıdır)

http://www.elektrikport.com

Teknoloji içinde yayınlandı | 3 Yorum

Azıcık soluklanma adına…

Uzun süreli bi suskunluğun ardından az da olsa birşeyler karalamak ihtiyacı duydum. Bundan sonra  vakit bulabildikçe birşeyler  paylaşmaya çalışıcam. Fakat derslerin yoğunluğundan ne kadar vakit bulabilirim pekte emin değilim:( Sınav yorgunluğu arasında birazcıkta olsun soluklanmak adına ufak birşeyler yazmak istedim. Hem biraz rahatlanmak adına hemde birşeyler karalamak adına. Vize stresi… Ne kadar zorlasakta dersten kalacak olma riski yüksek derslerle sürekli haşir neşir olmak ama yinede istenilen seviyeye gelememek. Okuldan bekleneni alamamak sürekli kendin öğrenmeye çalışmak. Okuldan soğumak için iyi nedenler olsa gerek. Açıkçası eğitimcilerimizin bu konuda birşeyler yapması gerektiğini düşünüyorum. Aslında içimde biriken haykırmak istediğim çok şey var ama pek te uzatmak konunun derinliklerine inmek istemiyorum. Zaten bilinen ama bir türlü düzeltilemeyen şeyler. Üniversitesi için 4 sene hayattan 2 sene kayıp olduğu görüşündeyim. Olması gereken eğitim verilse 4 değil 6 7 olsa az ama malesef dediğim gibi 2 sene kayıp. Keşke daha iyi olsa ama umarım gelecek nesillere.

Temennilerimle.

 

Sinan Ergin(22.36) (700 sayfalık sınav notuna çalışmaktan sıkıldığım bunaldığım ara…)

 

| 2 Yorum

Basketbol Milli Takımımızın Başarısı

Basketbol Milli Takımımıza çok teşekkür ediyoruz bize bu duyguyu bu mutluluğu yaşattıkları için.Bu yılki Dünya Şampiyonası ülkemizde yapıldı. 12 Dev Adamımız final maçı heyecanını bizlere yaşattı. Güçlü ABD karşısında mağlup olmamıza rağmen bizi final heyacanını yaşattıkları için çok teşekkür ederiz. Dünya 2.liğini tarihimizde ilk defa yaşattılar bizlere. İyiki varsın 12 Dev Adam.

| Yorum bırakın